Genomic Medicine and Bioinformatics Core Facility

Introduction

The Genomic Medicine and Bioinformatics Core Facility has provided genomic and transcriptomic services to the local and international scientific community for almost 20 years. Our genomic services are available to academic and commercial users. We manage samples for genomic projects starting from quantitative and qualitative analysis of RNA/DNA up to next generation sequencing (NGS) and data analyses using various NGS platforms. In addition, the Core Facility continues to offer a variety of traditional genomic methods, including Sanger sequencing and real-time quantitative PCR. Moreover, we deliver advice on experimental design, bioinformatics assistance and training.

The Genomic Medicine and Bioinformatics Core Facility is hosted by the Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Debrecen.

 

We provide the following services:

Next generation sequencing (NGS)

Sanger sequencing

Real-time quantitative PCR (RT-QPCR)

DNA/RNA quality control and quantitation

Bioinformatics analyses

Contact us

Genomic Medicine and Bioinformatics Core Facility, Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Debrecen

H-4032, Nagyerdei krt. 98. Debrecen, Hungary

In Vitro Diagnostic Building

Phone: +36 52 411 717/50005

 

István Szatmári Head of the Core Facility

e-mail: szatmari@med.unideb.hu

phone: +36 52 411 717/50015

 

Szilárd Póliska Genomics Unit coordinator

e-mail: poliska@med.unideb.hu

phone: +36 52 411 717/50216, 50210

 

Lajos Széles Bioinformatics Unit coordinator

e-mail: szelesl@med.unideb.hu

phone: +36 52 411 717/50216

 

Members

István Szatmári

associate professor, Head of the Core Facility

e-mail: szatmari@med.unideb.hu

phone: +36 52 411 717/50015

 

Szilárd Póliska

assistant research fellow, Genomics Unit coordinator

e-mail: poliska@med.unideb.hu

phone: +36 52 411 717/50216, 50210

 

Lajos Széles

assistant professor, Bioinformatics Unit coordinator

e-mail: szelesl@med.unideb.hu

phone: +36 52 411 717/50216

 

Bálint László Bálint

assistant professor, Genomics trainings coordinator

e-mail: lbalint@med.unideb.hu

phone: +36 52 411 717/50066

 

Beáta Scholtz

associate professor, Biobanking service coordinator

e-mail: scholtz@med.unideb.hu

phone: +36 52 411 717/50219

 

Endre Barta

associate professor, bioinformatician

e-mail: barta.endre@unideb.hu

phone: +36 52 411 717/50215

 

Erzsébet Mátyás

biologist

e-mail: matyas.erzsebet@med.unideb.hu

phone: +36 52 411 717/50014, 50210

 

Irén Mező

research assistant

e-mail: mezoi@med.unideb.hu

phone: +36 52 411 717/50201

 

Ágnes Fazekas-Bálint

assistant manager

e-mail: agnes.balint@med.unideb.hu

phone: +36 52 411 717/50005

 

NGS service

Next generation sequencing (NGS) service

NGS is a high-throughput technology that enables rapid sequencing of various DNA or RNA samples. With its high throughput and speed, NGS enables researchers to carry out a wide variety of applications including gene expression profiling, detection of epigenetic changes and metagenome or whole genome sequencing. NGS is driving genomic and transcriptomic discoveries and enabling the future of personalized medicine.

We offer NGS sequencing services on Illumina MiSeq or NextSeq 500 instruments.

 

Instrumentation

Illumina NextSeq 500

This NGS machine is suitable to sequence single or paired-end reads, and flow cells are available in configurations for high output and mid output. With tunable output and high data quality, this instrument is suitable for many NGS based applications.

Performance parameters:

Flow cell configuration

Read length

Output (Gb/run)

Run-time (hour)

Data quality

High-output flow cell (400 M single read, 800 M paired-end read)

1 x 75 bp

30

11

> 80% > Q30

2 x 75 bp

60

18

> 80% > Q30

2 x 150 bp

120

29

> 75% > Q30

Mid-output flow cell (130 M single read, 260 M paired-end read)

2 x 75 bp

19

15

> 80% > Q30

2 x 150 bp

39

26

> 75% > Q30

Illumina NextSeq 500 instruments

 

Illumina MiSeq

This benchtop NGS machine is suitable to generate 15 Gb of output with 25 million reads and 2×300 bp read lengths. With tunable output and high data quality, this instrument can be used for several NGS based applications such as targeted genome sequencing, metagenomics and small genome sequencing.

 

We can provide the following NGS applications (from library preparation to FASTQ files):

1. Whole genome sequencing

2. Whole exome or target genome sequencing

3. mRNA sequencing (polyA selection)

4. Stranded RNA sequencing (depletion of ribosomal RNA)

5. microRNA sequencing

6. ChIP-Seq

7. Metagenomic sequencing

16S V3-V4 region sequencing

shotgun sequencing

8. Amplicon sequencing

 

Please contact us regarding your research project so we can discuss different NGS methods that could be applicable to your genomic experiments.

 

NGS data storage and transfer

After the sequencing reaction we employ demultiplexing and provide FASTQ files.

FASTQ files are transiently stored in password protected folders of our FTP server. Importantly, NGS raw data files must be transferred and archived by the costumers. We only transiently (8 weeks) store FASTQ files, after that the raw data are deleted.

 

contact person: Szilárd Póliska

e-mail: poliska@med.unideb.hu

phone: +36 52 411 717/50216, 50210

 

 

 

 

 

Sanger sequencing

Instrumentation

ABI PRISM 3100-Avant Genetic Analyzer (Thermo Fisher Scientific)

This sequencing instrument is equipped with four capillaries (length 50 cm) and calibrated with BigDye 3.1 or BigDye 1.1 chemistry. This sequencing machine is suitable to generate 600 bp reads.

Service

  • Plasmid sequencing

  • PCR product sequencing

We also provide general sequencing primers:

 

Primers

sequences

T7 promoter

GTAATACGACTCACTATAGGG

T7 terminator

GCTAGTTATTGCTCAGCGG

T3

CAATTAACCCTCACTAAAGG

SP6

TACGATTTAGGTGACACTATAG

-21M13 Forward

TGTAAAACGACGGCCAGT

M13 Reverse

CAGGAAACAGCTATGAC

BGH Reverse

TAGAAGGCACAGTCGAGG

PGEX Forward

GGGCTGGCAAGCCACGTTTGGTG

PGEX Reverse

CCGGGAGCTGCATGTGTCAGAGG

 

Other oligonucleotide primers must be provided by the users (10 mM, volume: 2ml/reaction).

 

Sample types

  • purified sequencing reaction products

  • sequencing reaction products without purification

  • DNA

    • PCR product (amplified DNA): 30 ng for one sequencing reaction

    • Plasmid: 300 ng for one sequencing reaction

Sequence results are provided by email. All sequence data are submitted to the users in ’seq’ and ’txt’ format. The DNA sequence chromatogram file ‘ab1’ can be open with the following software:

 

 

Fragment analysis

  • DS-30 filter D dye set calibration: 6FAM, HEX, NED, ROX

  • DS-33 filter G5 dye set calibration: 6FAM, VIC, NED, PET, LIZ

We can only sequence those samples which are compatible with the DS-30 or DS-33 calibration. Further information about the available fragment analysis kits or reaction improvement can be obtained from the Thermo Fisher Scientific’s representatives.

 

contact person: Szilárd Póliska

e-mail: poliska@med.unideb.hu

phone: +36 52 411 717/50216, 50210

RT-QPCR service

Real-time quantitative PCR (RT-QPCR)

Real-time quantitative PCR technique is suitable to assess gene expression via absolute or relative quantitation of mRNA transcripts, in addition, genetic alterations - polymorphism or copy number variations - can be detected with this method.

Our Core Facility contains three RT-QPCR equipment which can be used after training. On line registration is needed in our web calendar to reserve and using the PCR instruments (http://nlab.med.unideb.hu/~cal/index.php)

 

Instrumentation

Roche LC480 (384) (Life Science Building, 3rd floor, room number: 3.043)

This instrument is installed with a 384-well PCR block. Please use the recommended Roche PCR plate (cat number: 05102430001 LightCycler® 480 Multiwell Plate 384, clear) for this equipment. If somebody apply a different kind of PCR plate, in that case, all service cost must be refunded upon instrument damage or malfunction.

Roche LC480 (96) (In Vitro Diagnostic Building, 3rd floor, room number: 3.16.4)

This instrument is installed with a 96-well PCR block, please use the recommended Roche PCR plate (cat number: 05102413001 LightCycler® 480 Multiwell Plate 96, clear) for this equipment. If somebody apply a different kind of PCR plate, in that case, all service cost must be refunded upon instrument damage or malfunction.

QuantStudio 12K Flex (In Vitro Diagnostic Building, 3rd floor, room number: 3.16.4)

The QuantStudio real-time PCR (Thermo Fisher Scientific) instrument is equipped with four type of PCR blocks; default format: fast 96 well block. If you want to use a different type of block, please indicate it online, moreover, contact with Szilárd Poliska via email (poliska@med.unideb.hu).

 

contact person: Szilárd Póliska

e-mail: poliska@med.unideb.hu

phone: +36 52 411 717/50216, 50210

DNA/RNA quality control and quantitation

We provide quality control service using the Agilent Bioanalyzer system for both DNA and RNA and quantification using a Qubit fluorometer.

Instrumentation

Agilent BioAnalyzer 2100

RNA integrity analysis

  • RNA 6000 Nano chip: 12 RNA samples can be analyzed; quantitative range range: 25 – 500 ng/ml; sample volume 1 ml.
  • RNA 6000 Pico chip: 11 RNA samples can be analyzed; quantitative range range: 50 – 5000 pg/ml; sample volume 1 ml.

DNA quantitation and fragment size analysis:

  • DNA7500 chip: 12 DNA samples can be analyzed; fragment size range: 35-10380 bp; quantitative range range: 0.5 – 50 ng/m; sample volume 1 ml.
  • DNA1000 chip: 12 DNA samples can be analyzed; fragment size range: 15-1500 bp; quantitative range range: 0.5 – 50 ng/m; sample volume 1 ml.
  • DNA HighSensitivity chip: 11 DNA samples can be analyzed; fragment size range: 50-7000 bp; quantitative range: 5 – 500 pg/ml; sample volume 1 ml.

 

Agilent BioAnalyzer 2100

 

Qubit fluorometer

This benchtop fluorometer is suitable for the quantitation of DNA using the highly sensitive and accurate fluorescence-based assays; concentration range: 0.1-100 ng/ml.

 

contact person: Szilárd Póliska

e-mail: poliska@med.unideb.hu

phone: +36 52 411 717/50216, 50210

Rates

contact person: Szilárd Póliska

e-mail: poliska@med.unideb.hu

phone: +36 52 411 717/50216, 50210

Bioinformatics Services

1. Services

1.      Storage and primary analysis of Illumina NGS data (e.g. QC and alignments). Our FTP server allows the downloading data in fastq, BAM and other files.

2.      Providing access to the HPC (high performance computing) cluster for analysis and data storage. Data is stored in a redundant array of independent disks 6  (RAID6) configuration.

3.      Reference genomes, bioinformatics programs, and pipe-lines for ChIP-seq, RNA-seq and ATAC-seq analyses are regularly up-dated by the staff.

4.      Complex analyses of RNA-seq data: QC, identification of differentially expressed genes, statistical and pathway analyses, data visualization for collaborators.

5.      Organizing courses, operating LIMS system, providing data analyses in large projects as members of Consortiums.

 

2. Key parameters of the HPC cluster

2.1. External storage with app. 100 TB capacity in RAID6 configuration 

2.2. Fatnodes and compute nodes

·         Head (admin) node - CPU: 44, memory: 126 GB

·         n001, n002, n003, n004, n005, n006 CPU: 12, memory: 46 GB

·         n007 - CPU: 44, memory: 251 GB

·         n008 - CPU: 12,  memory: 142 Gb

·         n009 - CPU: 12, memory: 125Gb
 

 

3. Genomes and Key programs

3.1. Genomes

Mus musculus: mm9, mm10
Homo sapiens: hg18, hg19
Rattus norvegicus: rn4
Saccharomyces cerevisiae: S288c
Vitis vinifera: Vit.vin.GCA_000003745.2
Prunus persica: Pru.per.GCA_000346465.1
Malus domestica: Mal.dom.GCF_000148765.1
Solanum lycopersicum: Sol.lyc.SL2.50
Nicotiana benthamiana: Nic.ben.v1.0.1
 

3.2. Key programs
/data2/programs/tophat-2.1.1.Linux_x86_64/tophat
/data2/programs/cufflinks-2.2.1.Linux_x86_64
/data2/programs/bowtie2-2.2.8
/data2/programs/maker/bin/maker
/molbio/bin/RNA-seq_dj-ah/RNA-seq_main_v3-2.sh
/molbio/bin/ChIP-seq/ChIP-seq_anal-v1_9.sh
/data2/programs/bcftools/bcftools-1.3 - Tools for variant calling and manipulating VCFs and BCFs
/data2/programs/bwa/bwa-0.7.12/ – alignment via Burrows-Wheeler transformation
/data2/programs/impute_v2.3.2 – imputation tool
/data2/programs/R-3.2.3/
/data2/programs/tophat-2.1.1 TopHat maps short sequences from spliced transcripts to whole genomes

 

Further details:

http://genbioinfo.med.unideb.hu/

 

contact person: Lajos Széles

e-mail: szelesl@med.unideb.hu

phone: +36 52 411 717/50216

Archive

Useful links