Genomi Medicina és Bioinformatikai Szolgáltató Laboratórium

Köszöntő

Tisztelt Látogató!

Köszöntöm a Biokémiai és Molekuláris Biológiai Intézet Genomi Medicina és Bioinformatikai Szolgáltató Laboratórium (GENOMIKA) oldalán.

Szolgáltató laboratóriumunk 2001-es létrehozásának célja az volt, hogy az egyetem kutatói számára biztosítsa a hozzáférést a legújabb genomikai technológiákhoz, és elősegítse a tudományos élet és az ipar közötti együttműködés kiépítését a genomika területén. Honlapunk segítséget nyújt ahhoz, hogy megismerjék szolgáltató laboratóriumunk tevékenységét, szolgáltatásainkat.

A GENOMIKA valamennyi munkatársa nevében tisztelettel köszönöm, hogy ellátogatott honlapunkra. Munkatársaink készséggel állnak rendelkezésére, amennyiben szakmai, a szolgáltatásainkat érintő kérdése van.

Dr. Szatmári István

egyetemi docens, szakmai vezető

Munkatársaink

Dr. Szatmári István

egyetemi docens, szakmai vezető

e-mail: szatmari@med.unideb.hu

telefon: +36 52 411 717/50015

 

Dr. Bálint Bálint László

adjunktus, genomikai és bioinformatikai tréningek vezetője

e-mail: lbalint@med.unideb.hu

telefon: +36 52 411 717/50219

 

Dr. Póliska Szilárd

tudományos munkatárs, a genomikai szolgáltatások vezetője

e-mail: poliska@med.unideb.hu

telefon: +36 52 411 717/50216, 50210

 

Dr. Széles Lajos

adjunktus, a bioinformatikai szolgáltatások vezetője

e-mail: szelesl@med.unideb.hu

telefon: +36 52 411 717/50216

 

Dr. Scholtz Beáta

egyetemi docens, biobanking szolgáltatások

e-mail: scholtz@med.unideb.hu

telefon: +36 52 411 717/502019

 

Dr. Bartha Endre

egyetemi docens, bioinformatikai tanácsadó

e-mail: scholtz@med.unideb.hu

telefon: +36 52 411 717/502019

 

Mátyás Erzsébet

biológus

e-mail: matyas.erzsebet@med.unideb.hu

telefon: +36 52 411 717/50014, 50210

 

Mező Irén

laboratóriumi asszisztens

e-mail: mezoi@med.unideb.hu

telefon: +36 52 411 717/50201, 50014

 

Iroda Fazekas-Bálint Ágnes

ügyvivő-szakértő

e-mail: agnes.balint@med.unideb.hu

telefon: +36 52 411 717/50230

 

RT-QPCR szolgáltatás

Szakmai felelős: Dr. Póliska Szilárd, tudományos munkatárs

e-mail: poliska@med.unideb.hu; telefon: +36 52 411 717/50216, 50210

 

Valós idejű (real-time) kvantitatív PCR (RT-QPCR)

A valós idejű kvantitatív PCR technika alkalmas génexpressziós vizsgálatokban mRNS molekulák abszolút és relatív kvantitálására, továbbá genetikai eltérések – polimorfizmusok, kópiaszám változások – detektálására.

A szolgáltató laboratóriumban 3 db RT-QPCR készülék érhető el, amelyeket a felhasználók betanítás után önállóan használhatnak. A használat időpontját az on-line műszerfoglalási naptárban (http://nlab.med.unideb.hu/~cal/index.php) kell lefoglalni, amelybe minden jogosult felhasználónak regisztrálnia kell saját név és szervezeti egység megadásával.

 

Készülékek

Roche LC480 (384) (Élettudományi Épület, 3. Emelet, 3.043, Műszerszoba)

A készülék 384 lyukú PCR blokkal ellátott, csak a Roche által forgalmazott 384 lyukú PCR plate használható a mérésekhez (katalógus szám: 05102430001 LightCycler® 480 Multiwell Plate 384, clear). Ha valamely felhasználó más forgalmazó által gyártott PCR plate-et használ és az műszaki problémát okoz, akkor a teljes szervizköltség a felhasználót terheli.

 

Roche LC480 (96) (In-Vitro Diagnosztikai Épület, 3. Emelet, 3.16.4, Műszerszoba)

A készülék 96 lyukú PCR blokkal ellátott, csak a Roche által forgalmazott 96 lyukú PCR plate használható a mérésekhez (katalógus szám: 05102413001 LightCycler® 480 Multiwell Plate 96, clear). Ha valamely felhasználó más forgalmazó által gyártott PCR plate-et használ és az műszaki problémát okoz, akkor a teljes szervizköltség a felhasználót terheli.

 

QuantStudio 12K Flex (ThermoFisher Scientific) (In-Vitro Diagnosztikai Épület, 3. Emelet, 3.16.4, Műszerszoba)

A készülék négy különböző PCR blokkal felszerelt, alapesetben a fast 96 lyukú blokkot tartalmazza a készülék. Kérjük a felhasználókat, hogy ettől eltérő igény esetén jelezzék a használni kívánt blokk típusát a műszerfoglalási naptárban, illetve e-mailben a következő e-mail címre poliska@med.unideb.hu:

 

Sanger szekvenálás és fragmentanalízis

Szakmai felelős: Dr. Póliska Szilárd, tudományos munkatárs

e-mail: poliska@med.unideb.hu; telefon: +36 52 411 717/50216, 50210

 

Készülék

ABI PRISM® 3100-Avant Genetic Analyzer

4 kapillárisos szekvenáló készülék, 50 cm hosszúságú kapillárissal, BigDye 3.1 és BigDye 1.1 szekvenáló kémiára kalibrálva. 600 bázis hosszúságú, jó minőségű szekvenciák generálásra alkalmas.

 

Szolgáltatás
  • Plazmid szekvenálás
  • PCR termék szekvenálás
  • Általános szekvenáló primerek biztosítása

 

Primer neve

Primer szekvenciája

T7 promoter

GTAATACGACTCACTATAGGG

T7 terminator

GCTAGTTATTGCTCAGCGG

T3

CAATTAACCCTCACTAAAGG

SP6

TACGATTTAGGTGACACTATAG

-21M13 Forward

TGTAAAACGACGGCCAGT

M13 Reverse

CAGGAAACAGCTATGAC

BGH Reverse

TAGAAGGCACAGTCGAGG

PGEX Forward

GGGCTGGCAAGCCACGTTTGGTG

PGEX Reverse

CCGGGAGCTGCATGTGTCAGAGG

 

 

Speciális primerrel történő szekvenálás esetén a primert megrendelő személy biztosítja, a szükséges mennyiség 10mM-os koncentrációjú primerből 2ml/reakció.

 

Fogadott minta

  • Tisztított, szekvenálási PCR utáni termék.
  • Szekvenálási PCR termék, tisztítás nélkül
  • Nukleinsav
    • PCR termék: 30 ng mennyiség/szekvenálási reakció
    • Plazmid: 300 ng mennyiség/szekvenálási reakció

 

Az adatokat e-mailben kapja meg a megrendelő. A futtatások eredményét mintánként két fájl tartalmazza. A ’seq’ kiterjesztésű a szekvenciát tartalmazza, ’txt’ fájlként megnyitható. Az ‘ab1’ kiterjesztésű fájl tartalmazza az elektroferogrammot, amely a következő ingyenes programokkal megnyitható:

 

Fragmentanalízis

  • DS-30 filter D festék szet kalibráció: 6FAM, HEX, NED, ROX.
  • DS-33 filter G5 festék szet kalibráció: 6FAM, VIC, NED, PET, LIZ

Csak a megrendelő által előkészített, a DS-30 vagy DS-33 kalibrációkkal kompatibilis mintákat tudjuk fogadni. A fragmentanalízissel kapcsolatban felmerülő további kérdésekkel (kitek, reakció optimalizálás) kérjük, forduljon a ThermoFisher Scientific képviselőihez.

 

NGS szolgáltatások

Szakmai felelős: Dr. Póliska Szilárd, tudományos munkatárs

e-mail: poliska@med.unideb.hu; telefon: +36 52 411 717/50216, 50210

 

Újgenerációs szekvenálási szolgáltatás (NGS)

Az újgenerációs szekvenálási technológia alkalmazásával elérhetővé vált rövid idő alatt nagy mennyiségű szekvenciaadat generálása, a módszer alkalmas komplex biológiai problémák vizsgálatára: teljes vagy célzott genom, transzkriptóm-szekvenálás, epigenetikai vizsgálatok, metagenom-szekvenálás.

A Genomi Medicina és Bioinformatikai Szolgáltató Laboratóriumban az Illumina által fejlesztett NextSeq500 és MiSeq készülékeken az alább felsorolt vizsgálatok kivitelezhetőek.

 

Készülékek

Illumina NextSeq500

A készülék alkalmas úgynevezett single read és paired-end szekvenálási futtatásokra, a leolvasás hosszúsága rugalmasan változtatható, így a legtöbb NGS applikációra alkalmazható.

Kapacitás:

Flow cel konfiguráció

Leolvasás hossza

Adatmennyiség (giga bázispár)

Futási idő (óra)

Adatminőség

High-output flow cel (400 M single read, 800 M paired-end read)

1 x 75 bp

30

11

> 80% > Q30

2 x 75 bp

60

18

> 80% > Q30

2 x 150 bp

120

29

> 75% > Q30

Mid-output flow cel (130 M single read, 260 M paired-end read)

2 x 75 bp

19

15

> 80% > Q30

2 x 150 bp

39

26

> 75% > Q30

 

Illumina MiSeq

Az Illumina MiSeq az egyik első úgynevezett benchtop szekvenáló készülék. Célzott génpanel, metagenom, amplikon, kisméretű genomok szekvenálására alkalmas készülék. A legújabb szekvenáló reagens használatával 25 millió 2 x 300 bp hosszúságú paired-end szekvenálási leolvasat generálható, ami ~15 giga bázispár adatmennyiséget jelent.

 

Szolgáltatás szintjén elérhető NGS applikációk (könyvtárkészítéstől a fastq fájlig):

1. Teljes genom szekvenálás

2. Teljes exom vagy célzott genom szekvenálás

3. mRNS szekvenálás (polyA szelektált)

4. Direkcionális/Stranded RNS szekvenálás (riboszómális RNS depletált)

5. mikroRNS szekvenálás

6. ChIP-Seq

7. Metagenom szekvenálás

  • 16S V3-V4 régió alapú
  • shotgun szekvenálás alapú

8. Amplikon szekvenálás

 

Szekvenálási adatok átadása/tárolása

A szekvenálási futás után a szolgáltatás részeként elvégezzük a minták demultiplexelését és a FASTQ fájlok létrehozását.

A FASTQ fájlokat az FTP szerverünkön jelszóval védett mappában tesszük elérhetővé.

Az adatok archiválása a megrendelő érdeke és felelőssége, aminek fontosságára ezúton is szeretnénk felhívni a figyelmet: az FTP szerveren megosztott adatot az átadástól számítva 2 hónapig (8 hét) tudjuk megőrizni, ezután az adatokat töröljük.

 

Minden szekvenálási futtatást a legnagyobb figyelemmel és szakértelemmel kivitelezzük azért, hogy megrendelőink számára jó minőségű adatot generáljunk és adjunk át, azonban nem tudnunk felelősséget vállalni a nem megfelelően előkészített minták esetében, így nem tudjuk garantálni, hogy a szekvenálási adat mennyisége/minősége megfelelő szintű ha:

a szekvenálási könyvtárat a megrendelő készítette elő, mivel limitált az ellenőrzési lehetőségünk a könyvtárak minőségére;

a szekvenálásra küldött minták mennyiségi és minőségi paraméterei nem felelnek meg az általunk megadott kritériumoknak;

nem Illumina (TruSeq vagy Nextera) barcode rendszer alkalmazása esetén.

 

DNS/RNS minőségi és mennyiségi meghatározás

Szakmai felelős: Dr. Póliska Szilárd, tudományos munkatárs

e-mail: poliska@med.unideb.hu; telefon: +36 52 411 717/50216, 50210

 

Készülékek

Agilent BioAnalyzer 2100

  • RNS-minták integritásának meghatározása:
    • RNA 6000 Nano chip: 12 db RNS-minta egyszerre történő minőségi és mennyiségi meghatározása 25 – 500 ng/ml koncentrációjú mintából, felhasznált mintatérfogat 1 ml.
    • RNA 6000 Pico chip: 11 db RNS-minta egyszerre történő minőségi és mennyiségi meghatározása 50 – 5000 pg/ml koncentrációjú mintából, felhasznált mintatérfogat 1 ml.
  • DNS-minták mennyiségi/minőségi és fragmentméret-eloszlásának meghatározása:
    • DNA7500 chip: 12 db DNS-minta egyszerre történő minőségi és mennyiségi mérése, valamint fragmentméret-eloszlásának meghatározása 35 bp és 10380 bp tartományban 0.5 – 50 ng/ml koncentrációjú mintából, felhasznált mintatérfogat 1 ml.
    • DNA1000 chip: 12 db DNS-minta egyszerre történő minőségi és mennyiségi mérése, valamint fragmentméret-eloszlásának meghatározása 15bp és 1500 bp tartományban 0.1 – 50 ng/ml koncentrációjú mintából, felhasznált mintatérfogat 1 ml.
    • DNA HighSensitivity chip: 11 db DNS-minta egyszerre történő minőségi és mennyiségi mérése, valamint fragmentméret-eloszlásának meghatározása 35 bp és 10380 bp tartományban 0.5 – 20 ng/ml koncentrációjú mintából, felhasznált mintatérfogat 1 ml.

 

Qubit fluoriméter

DNS-minták fluorimetriás alapú mennyiségi meghatározása 0.1 – 100 ng/ml koncentráció tartományban.

 

 

A genomikai szolgáltatások árai

Szakmai felelős: Dr. Póliska Szilárd, tudományos munkatárs

e-mail: poliska@med.unideb.hu; telefon: +36 52 411 717/50216, 50210

Az árak egyetemi belső keretáthelyezéssel történő fizetésre vonatkoznak!

 

 

 

Bioinformatikai szolgáltatások

szakmai felelős: Dr. Széles Lajos, adjunktus

e-mail: szelesl@med.unideb.hu; telefon: +36 52 411 717/50216

 

Bioinformatikai Alegység feladatkörei

1. Az Illumina NGS (Next Generation Sequencing) szekvenátoron elvégzett futtatásokhoz kapcsolódó elsődleges bioinformatikai elemzések (fastq és bam file-ok létrehozása).

2. Az NGS klaszter felhasználói számára nyújtott szolgáltatások (adattárolás, számítási kapacitás biztosítása, genomok és programok telepítése és frissítése, pipeline-ok biztosítása, fellépő hibák elhárítása).

3. Szolgáltatási feladatok kollaborátorok és ügyfelek részére. Többek között: transzkriptomikai és genomikai elemzések, tanácsadás és adatok vizualizációja.

4. Az egység működéséhez/fejlesztéséhez kapcsolható tevékenységek kurzusok és szemináriumok szervezése, pályázatokban partnerként megjelenés, LIMS rendszer bevezetése, műszerfoglalási naptárok, bioinformatikai fejlesztési stratégia kialakítása, és adatbiztonsági rutin kialakítása.

 

Szolgáltatásként nyújtott transzkriptomikai elemzéseket jelenleg két szinten végezzük:

I. Alapelemzés

1. Minőségellenőrzés (PCA-alapú)

2. kísérleti csoportokban eltérő génexpressziót mutató gének azonosítása és listák elkészítése (p-érték és “fold-induction”) 3. Listák egyszerű összevetése és vizualizációja (heat-map és Venn-diagram)

II. Komplex elemzés

1. Minőségellenőrzés (PCA-alapú), pl. az adott kondíció többi mintájától eltérő minta (“outlier”) azonosítása 2. Kísérleti csoportokban eltérő génexpressziót mutató gének azonosítása és listák elkészítése (p-érték és “fold-induction”) 3. Gének útvonal (pathway) és GO-kategóriák szerinti elemzése 4. Expresszió-mintázat alapján történő klaszterezés 5. Cikk-minőségű ábrák készítése, pl. scatter-plot, volcano-plot, Venn-diagram, hierarchikusan rendezett génlisták heatmap vizualizációja 6. Ezeket a megrendelő igényei alapján 3-4 konzultáció során egyeztetve véglegesítjük

 

További részletek:

http://genbioinfo.med.unideb.hu/

Archívum

Korábbi Genomika weboldal:

http://genomics.med.unideb.hu/index.php